Review



case 4  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs case 4
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Case 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8706 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/pmc12910572-75-25-32
    Average 99 stars, based on 8706 article reviews
    case 4 - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "Functional analysis of AIP variants in a cohort of neuroendocrine neoplasms"

    Article Title: Functional analysis of AIP variants in a cohort of neuroendocrine neoplasms

    Journal: Endocrine-Related Cancer

    doi: 10.1530/ERC-25-0095

    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Figure Legend Snippet: Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.

    Techniques Used: Functional Assay, Sequencing, Variant Assay, TA Cloning, Western Blot, Expressing, Blocking Assay, Real-time Polymerase Chain Reaction, Control

    Related Articles

    Sequencing:

    Article Title: Improving Genetic Diagnostics and Developing Gene Therapies in Rare Muscle Diseases
    Article Snippet: Addgene plasmids 179682, 179683, and 179686 were gifts from David Liu. .. 3047-3075-F TCACCAGTCAAAGCGAACTACT 3047-3075-R GGGTACAATGAGGAGTAGGAGGTT 5147-F CCAAATCTCTCCCTCACTAAACG Difficult template for Sanger sequencing 5147-R AGGTAGGAGTAGCGTGGTAAG Difficult template for Sanger sequencing Targeted PCR was performed with the following conditions: QS Rxn buffer 10 wL 1 | 98°C hot start QS Enh buffer 10 wL 2 | 98°C 3 mins QS polymerase 1pL 3 | 98°C 8s (NEB, M0491S) 4 | Annealing temperature* 15s 10 mM dNTPs 1 yl 5 72°C 15s DNA extracted from cells | 400 ng 6 | Repeat 3-5 for 34 more cycles 10 uM F primer 2.5 wL 7 |.72°C 5 mins 10 uM R primer 2.5 wL 8 | 12°C Forever Water To 50 wL *3047-3075: 67 °C; 5147: 66 °C Long-read PCR Fl_| CAGATATCAATAAGACATCACGATGGATCACA Long-read PCR F2_ | GITGCACGTAATAAGACATCACGATGGATCACA Long-read PCR F3_ | AGAACATTAATAAGACATCACGATGGATCACA Long-read PCR F4_ | AGTTATAAAATAAGACATCACGATGGATCACA Long-read PCR F5_ | GICTTCTTAATAAGACATCACGATGGATCACA Long-read PCR F6 TTAAACACAATAAGACATCACGATGGATCACA Long-read PCR F7 AATCTTCCAATAAGACATCACGATGGATCACA, Long-read PCR F8 TGCTCAGTAATAAGACATCACGATGGATCACA Long-read PCR R1 AGGGTTGCTAAGGGGAACGTGTGGGCTATTT Long-read PCR R2 CATGTGGATAAGGGGAACGTGTGGGCTATTT 105 .. Long-read PCR R3 GATTCCACTAAGGGGAACGTGTGGGCTATTT Long-read PCR R4 TACGATTCTAAGGGGAACGTGTGGGCTATTT Long-read PCR R5 GGTACATGTAAGGGGAACGTGTGGGCTATTT Long-read PCR R6 GTTATCGTTAAGGGGAACGTGTGGGCTATTT Long-read PCR R7 TATTGCTATAAGGGGAACGTGTGGGCTATTT Long-read PCR R8 GCCAGCCTTAAGGGGAACGTGTGGGCTATTT Long-read PCR was performed with the following conditions: DNA extracted from cells 400 ng 1 | 98°C hot start Phusion Master Mix with GC Buffer (2X) 25 aL 2 | 98°C 30s (Thermo Scientific, F532S) 3 | 98°C 30s 10 uM F primer 2.5 wL 4 | 63°C 30s 10 uM R primer 2.5 pL 5 | 72°C 9 mins DMSO 1.5 pL 6 _| Repeat 3-5 for 9 more cycles Water To 50 wL 7 | 98°C 30s Purification, size selection, and long-read sequencing were | 8 | 67 °C 30s performed at Yale Center for Genome Analysis (YCGA).

    Polymerase Chain Reaction:

    Article Title: Improving Genetic Diagnostics and Developing Gene Therapies in Rare Muscle Diseases
    Article Snippet: Addgene plasmids 179682, 179683, and 179686 were gifts from David Liu. .. 3047-3075-F TCACCAGTCAAAGCGAACTACT 3047-3075-R GGGTACAATGAGGAGTAGGAGGTT 5147-F CCAAATCTCTCCCTCACTAAACG Difficult template for Sanger sequencing 5147-R AGGTAGGAGTAGCGTGGTAAG Difficult template for Sanger sequencing Targeted PCR was performed with the following conditions: QS Rxn buffer 10 wL 1 | 98°C hot start QS Enh buffer 10 wL 2 | 98°C 3 mins QS polymerase 1pL 3 | 98°C 8s (NEB, M0491S) 4 | Annealing temperature* 15s 10 mM dNTPs 1 yl 5 72°C 15s DNA extracted from cells | 400 ng 6 | Repeat 3-5 for 34 more cycles 10 uM F primer 2.5 wL 7 |.72°C 5 mins 10 uM R primer 2.5 wL 8 | 12°C Forever Water To 50 wL *3047-3075: 67 °C; 5147: 66 °C Long-read PCR Fl_| CAGATATCAATAAGACATCACGATGGATCACA Long-read PCR F2_ | GITGCACGTAATAAGACATCACGATGGATCACA Long-read PCR F3_ | AGAACATTAATAAGACATCACGATGGATCACA Long-read PCR F4_ | AGTTATAAAATAAGACATCACGATGGATCACA Long-read PCR F5_ | GICTTCTTAATAAGACATCACGATGGATCACA Long-read PCR F6 TTAAACACAATAAGACATCACGATGGATCACA Long-read PCR F7 AATCTTCCAATAAGACATCACGATGGATCACA, Long-read PCR F8 TGCTCAGTAATAAGACATCACGATGGATCACA Long-read PCR R1 AGGGTTGCTAAGGGGAACGTGTGGGCTATTT Long-read PCR R2 CATGTGGATAAGGGGAACGTGTGGGCTATTT 105 .. Long-read PCR R3 GATTCCACTAAGGGGAACGTGTGGGCTATTT Long-read PCR R4 TACGATTCTAAGGGGAACGTGTGGGCTATTT Long-read PCR R5 GGTACATGTAAGGGGAACGTGTGGGCTATTT Long-read PCR R6 GTTATCGTTAAGGGGAACGTGTGGGCTATTT Long-read PCR R7 TATTGCTATAAGGGGAACGTGTGGGCTATTT Long-read PCR R8 GCCAGCCTTAAGGGGAACGTGTGGGCTATTT Long-read PCR was performed with the following conditions: DNA extracted from cells 400 ng 1 | 98°C hot start Phusion Master Mix with GC Buffer (2X) 25 aL 2 | 98°C 30s (Thermo Scientific, F532S) 3 | 98°C 30s 10 uM F primer 2.5 wL 4 | 63°C 30s 10 uM R primer 2.5 pL 5 | 72°C 9 mins DMSO 1.5 pL 6 _| Repeat 3-5 for 9 more cycles Water To 50 wL 7 | 98°C 30s Purification, size selection, and long-read sequencing were | 8 | 67 °C 30s performed at Yale Center for Genome Analysis (YCGA).



    Similar Products

    case 4  (New England Biolabs)
    99
    New England Biolabs case 4
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Case 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/pmc12910572-75-25-32
    Average 99 stars, based on 1 article reviews
    case 4 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    hx0603 4 q5 high fidelity dna polymerase new england biolabs  (New England Biolabs)
    99
    New England Biolabs hx0603 4 q5 high fidelity dna polymerase new england biolabs
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Hx0603 4 Q5 High Fidelity Dna Polymerase New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/pm40449002-46-47-52
    Average 99 stars, based on 1 article reviews
    hx0603 4 q5 high fidelity dna polymerase new england biolabs - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    ygm003a 4 q5 high fidelity dna polymerase new england biolabs  (New England Biolabs)
    99
    New England Biolabs ygm003a 4 q5 high fidelity dna polymerase new england biolabs
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Ygm003a 4 Q5 High Fidelity Dna Polymerase New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/pm40155267-232-91-96
    Average 99 stars, based on 1 article reviews
    ygm003a 4 q5 high fidelity dna polymerase new england biolabs - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    m0491s p  (MACHEREY NAGEL)
    93
    MACHEREY NAGEL m0491s p
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    M0491s P, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/NucleoMag+PCR+kit+for+PCR+clean+up+with+magnetic+beads/pm40010352-227-163-165
    Average 93 stars, based on 1 article reviews
    m0491s p - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    m0491s 4  (New England Biolabs)
    99
    New England Biolabs m0491s 4
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    M0491s 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/ma_kaiyue__2023__improving_genetic_diagnostics_and_developing_gene_therapies_in_rare_muscle_diseases-1191-54-53
    Average 99 stars, based on 1 article reviews
    m0491s 4 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    m0491s criterion pre cast gradient sds page gel  (Bio-Rad)
    96
    Bio-Rad m0491s criterion pre cast gradient sds page gel
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    M0491s Criterion Pre Cast Gradient Sds Page Gel, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/4%E2%80%9320%25+Criterion+TGX+Precast+Midi+Protein+Gel/pm35263593-224-81-88
    Average 96 stars, based on 1 article reviews
    m0491s criterion pre cast gradient sds page gel - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    thiouridine chemgenes rp 2304 q5 high fidelity dna polymerase neb m0491 rnase h neb m0297s critical  (New England Biolabs)
    99
    New England Biolabs thiouridine chemgenes rp 2304 q5 high fidelity dna polymerase neb m0491 rnase h neb m0297s critical
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Thiouridine Chemgenes Rp 2304 Q5 High Fidelity Dna Polymerase Neb M0491 Rnase H Neb M0297s Critical, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/10__2139_slash_ssrn__3543843-246-223-234
    Average 99 stars, based on 1 article reviews
    thiouridine chemgenes rp 2304 q5 high fidelity dna polymerase neb m0491 rnase h neb m0297s critical - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    lic  (New England Biolabs)
    99
    New England Biolabs lic
    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.
    Lic, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m0491s+4/Q5+High-Fidelity+DNA+Polymerase/pmc05841696-315-15-25
    Average 99 stars, based on 1 article reviews
    lic - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.

    Journal: Endocrine-Related Cancer

    Article Title: Functional analysis of AIP variants in a cohort of neuroendocrine neoplasms

    doi: 10.1530/ERC-25-0095

    Figure Lengend Snippet: Functional assessment of AIP variants. (A) Sanger sequencing results of blood (top) and formalin-fixed and paraffin-embedded (bottom) samples from Case 2. Heterozygous variants p.T231M and p.V291_L929del were identified in the blood sample, while tumor sample showed loss of p.T231M, preserved heterozygosity of p.V291_L929del, and the heterozygous somatic intronic variant c.787 + 9C>T. (B) Phasing analysis of the two germline variants detected in Case 2. Via TOPO-TA cloning and Sanger sequencing, we found that variants p.T231M and p.V291_L929del are in trans in peripheral blood DNA. Results for two representative colonies are shown. (C) Wild-type AIP and VOI, overexpressed in HEK293 cells and detected by Western blot (top). Bands for all variants, except p.R304*, were observed at 37 kDa (arrow). Quantification showed significantly reduced protein expression for p.V291_L292del and p.R304*, compared with wild-type AIP (bottom). (D) Half-life curve graph (left) and representative Western blot images (right) of the cycloheximide chase experiments for wild-type AIP and the VOI. A significantly reduced half-life was observed for the VUS p.V291_L292, compared with the wild-type protein. Similar results were obtained for the pathogenic variant p.R304*, as previously reported. The variant p.R106C displayed longer half-life than the wild-type protein, although this difference did not reach statistical significance. (E) Sanger sequencing results of blood (top) and two blocks (bottom) of a formalin-fixed and paraffin embedded (FFPE) gastric NET from Case 1. LOH at the variant locus is observed in one of samples (FFPE block 2). (F) Evaluation of the intronic variant c.787 + 9C>T by quantitative PCR (left) and Sanger sequencing (right). AIP expression in peripheral blood cDNA was significantly lower in three out of four apparently healthy controls, compared with Case 4. Under our experimental conditions, this heterozygous intronic variant did not result in alternative transcripts. ***, P < 0.001; ****, P < 0.0001; cDNA, coding DNA; gDNA, genomic DNA; h, hours; M1, male control 1; M2, male control 2; F1, female control 1; F2, female control 2; ns, not significant; wt, wild type.

    Article Snippet: An 1,157 bp region containing the full-length AIP coding DNA sequence ( NM_003977 ) was amplified using cDNA from HEK293 and peripheral blood cDNA from Case 4 with Q5 high-fidelity DNA Polymerase (New England Biolabs M0491S) and the primers 5′-GCT TCT GCC CTC AAC CAA AA-3′ and 5′-CAG TGG GCT TGG CAG GTA AG-3′.

    Techniques: Functional Assay, Sequencing, Variant Assay, TA Cloning, Western Blot, Expressing, Blocking Assay, Real-time Polymerase Chain Reaction, Control